View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2099_low_5 (Length: 248)
Name: NF2099_low_5
Description: NF2099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2099_low_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 55074665 - 55074888
Alignment:
| Q |
18 |
taaacctctcatagcttttctaattctgtgattcaactacgctaatttattattctcattgttgctttgggataatcagagttgaacaattctttgcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55074665 |
taaacctctcatagcttttctaattctgtgattcaactacgctaatttattattctcattgttgctttggcataatcagagttgaacaattctttgcatt |
55074764 |
T |
 |
| Q |
118 |
tatatatattctttcctaatatttcatcccatca-nnnnnnnnatgtgaaaatcatttggatctggaatcatcaagatcagggactcagggtggacacac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
55074765 |
tatatatattctttcctaatatttcatcccatcatttttttttatgtgaaaatcatttggatctggaatcatcaaga--------ttagggtggacacac |
55074856 |
T |
 |
| Q |
217 |
acatgtttttgttggatattggatacttacta |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55074857 |
acatgtttttgttggatattggatacttacta |
55074888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University