View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2099_low_7 (Length: 235)

Name: NF2099_low_7
Description: NF2099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2099_low_7
NF2099_low_7
[»] chr1 (2 HSPs)
chr1 (29-113)||(33294330-33294414)
chr1 (182-222)||(33294216-33294256)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 29 - 113
Target Start/End: Complemental strand, 33294414 - 33294330
Alignment:
29 aagaaactaatatggagtgacatagtaatatagtgctagcagaaccatgaagaaaagattaccatcaagggcttcatctttattc 113  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33294414 aagaaactaatatagagtgacatattaatatagtgctagcagaaccatgaagaaaagattaccatcaagggcttcatctttattc 33294330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 33294256 - 33294216
Alignment:
182 aggataaaattgaaaccgtgtgttgatccatttttcatctc 222  Q
    |||||||||||||||||||||||||||||||||||||||||    
33294256 aggataaaattgaaaccgtgtgttgatccatttttcatctc 33294216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University