View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2099_low_8 (Length: 233)
Name: NF2099_low_8
Description: NF2099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2099_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 35 - 219
Target Start/End: Complemental strand, 52787647 - 52787463
Alignment:
| Q |
35 |
atgaaaccgagtaagattcatttgtttgtgtacggtctttggtttggtttggctgacacgtgggcagcgatgcctgataacaaaatggtcggaaaagcaa |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52787647 |
atgaaaccgagtaagattcatttgtttgtgtacggtcttttgtttggtttggctgacacgtgggcagcgatgcctgataacaaaatggtcggaaaagcaa |
52787548 |
T |
 |
| Q |
135 |
ttagggatccaaataagttgaagattattgcatctaatccaaggaggtatacgggcccacctagagtagggaccatgagggaact |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52787547 |
ttagggatccaaataagttgaagattattgcttctaatccaaggaggtatacgggcccacctagagtagggaccatgagggaact |
52787463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University