View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2099_low_8 (Length: 233)

Name: NF2099_low_8
Description: NF2099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2099_low_8
NF2099_low_8
[»] chr4 (1 HSPs)
chr4 (35-219)||(52787463-52787647)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 35 - 219
Target Start/End: Complemental strand, 52787647 - 52787463
Alignment:
35 atgaaaccgagtaagattcatttgtttgtgtacggtctttggtttggtttggctgacacgtgggcagcgatgcctgataacaaaatggtcggaaaagcaa 134  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52787647 atgaaaccgagtaagattcatttgtttgtgtacggtcttttgtttggtttggctgacacgtgggcagcgatgcctgataacaaaatggtcggaaaagcaa 52787548  T
135 ttagggatccaaataagttgaagattattgcatctaatccaaggaggtatacgggcccacctagagtagggaccatgagggaact 219  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
52787547 ttagggatccaaataagttgaagattattgcttctaatccaaggaggtatacgggcccacctagagtagggaccatgagggaact 52787463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University