View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21000_high_17 (Length: 212)
Name: NF21000_high_17
Description: NF21000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21000_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 37768450 - 37768266
Alignment:
| Q |
11 |
ggagcagagacagtttcagattcaagcatgtcatctaaatcaatgacaggacgaaaacatgttaagaacttgttttttgaaacactcttcataattttct |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37768450 |
ggagcagggacagtttcagattcaagcatgtcatctaaatcaatgacaggacgaaaacatgttaagaacttgttttttgaaacactcttcataattttct |
37768351 |
T |
|
| Q |
111 |
aagttgtgtaagtttgagaaaggagttgatgatgatactaatgagtagtgataaagggttttagagagtttgagattagaagaatgtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37768350 |
aagttgtgtaagtttgagaaaggagttga---tgatactaataagtagtggtaaagggttttagagagttcgagattagaagaatgtg |
37768266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University