View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21000_high_7 (Length: 366)
Name: NF21000_high_7
Description: NF21000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21000_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 6e-56; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 4 - 126
Target Start/End: Original strand, 33530652 - 33530774
Alignment:
| Q |
4 |
agagagagataaatttggtaaacttgaaacaaacaacttgaatagttctatatccaaaataccattaatgttgattttaaaacattgctctcaagttcca |
103 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33530652 |
agagagagataaatttgataaacttgaaagaaacaacttgaataattctatatccaaaataccattaatgttgattttaaaacattgctctcaagttcca |
33530751 |
T |
 |
| Q |
104 |
aatcacaatagataactaacatg |
126 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33530752 |
aatcacaatagataactaacatg |
33530774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 235 - 359
Target Start/End: Original strand, 33538644 - 33538764
Alignment:
| Q |
235 |
gtgttttttctcgattgatcttttgcaacaaagattagttcaaactcttcgctagctcattatactgttatgtagacaaataacgacataataggtgaag |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33538644 |
gtgttttttctcgattgatcttttgcaacaaagattagttcaaactcttcgct----cattatactgttatgtagacaaataacgacataataggtgaag |
33538739 |
T |
 |
| Q |
335 |
aaaattagtaaggttttgatgatgt |
359 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33538740 |
aaaattagtaaggttttgatgatgt |
33538764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 146 - 186
Target Start/End: Original strand, 33530761 - 33530801
Alignment:
| Q |
146 |
agataactaacatgttatgtttcggtgttttcgttccttgc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33530761 |
agataactaacatgttatgtttcggtgttttcgttccttgc |
33530801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University