View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21000_high_8 (Length: 354)
Name: NF21000_high_8
Description: NF21000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21000_high_8 |
 |  |
|
| [»] scaffold0141 (3 HSPs) |
 |  |  |
|
| [»] scaffold0049 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0141 (Bit Score: 131; Significance: 7e-68; HSPs: 3)
Name: scaffold0141
Description:
Target: scaffold0141; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 89 - 227
Target Start/End: Original strand, 34447 - 34585
Alignment:
| Q |
89 |
cagtgccggttaattgaattgaagaaggttcatcgtacttcaccatttaattgaattgggagcgtacaaggggaattgaaatgattatgatgataatgtt |
188 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34447 |
cagtgccggttaattgaattgaagagggttcatcgtacatcaccatttaattgaattgggagcgtacaaggggaattgaaatgattatgatgataatgtt |
34546 |
T |
 |
| Q |
189 |
ggatatggtgtgagattgaggaattgagattgaagtgaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34547 |
ggatatggtgtgagattgaggaattgagattgaagtgaa |
34585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0141; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 218 - 354
Target Start/End: Complemental strand, 31919 - 31783
Alignment:
| Q |
218 |
ttgaagtgaagacgatgtgttggtttcgacggcgatttcgattcaacgcattaggaacatggtgtggaagaaggagatgaatgcagagggaatgaggaga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| | || || || |
|
|
| T |
31919 |
ttgaagtgaagacgatgtgttggtttcgacagcgatttcgattcaacgcattaggaacatggtgcggaagaaggagatgaattcagaggcattgtggtga |
31820 |
T |
 |
| Q |
318 |
cagaggtggaaggttttggatttgaagttgctaggat |
354 |
Q |
| |
|
||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
31819 |
cagcggtggaagtttttggatttaaagttgctaggat |
31783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0141; HSP #3
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 6 - 95
Target Start/End: Original strand, 31951 - 32040
Alignment:
| Q |
6 |
aaaaccagacccacatatcatcaaaaccttaaagcttcaacatttatctctttcttcctgattctaaacaattagtttttgaccagtgcc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31951 |
aaaaccagacccacatatcatcaaaaccttaaagcttcaacatttatctctttcttcctcattctaaacaattagtttttgaccagtgcc |
32040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 131; Significance: 7e-68; HSPs: 3)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 89 - 227
Target Start/End: Complemental strand, 80365 - 80227
Alignment:
| Q |
89 |
cagtgccggttaattgaattgaagaaggttcatcgtacttcaccatttaattgaattgggagcgtacaaggggaattgaaatgattatgatgataatgtt |
188 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
80365 |
cagtgccggttaattgaattgaagagggttcatcgtacatcaccatttaattgaattgggagcgtacaaggggaattgaaatgattatgatgataatgtt |
80266 |
T |
 |
| Q |
189 |
ggatatggtgtgagattgaggaattgagattgaagtgaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
80265 |
ggatatggtgtgagattgaggaattgagattgaagtgaa |
80227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 218 - 354
Target Start/End: Original strand, 82893 - 83029
Alignment:
| Q |
218 |
ttgaagtgaagacgatgtgttggtttcgacggcgatttcgattcaacgcattaggaacatggtgtggaagaaggagatgaatgcagagggaatgaggaga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| | || || || |
|
|
| T |
82893 |
ttgaagtgaagacgatgtgttggtttcgacagcgatttcgattcaacgcattaggaacatggtgcggaagaaggagatgaattcagaggcattgtggtga |
82992 |
T |
 |
| Q |
318 |
cagaggtggaaggttttggatttgaagttgctaggat |
354 |
Q |
| |
|
||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
82993 |
cagcggtggaagtttttggatttaaagttgctaggat |
83029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049; HSP #3
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 6 - 95
Target Start/End: Complemental strand, 82861 - 82772
Alignment:
| Q |
6 |
aaaaccagacccacatatcatcaaaaccttaaagcttcaacatttatctctttcttcctgattctaaacaattagtttttgaccagtgcc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
82861 |
aaaaccagacccacatatcatcaaaaccttaaagcttcaacatttatctctttcttcctcattctaaacaattagtttttgaccagtgcc |
82772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University