View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21000_low_16 (Length: 238)
Name: NF21000_low_16
Description: NF21000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21000_low_16 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 7971552 - 7971332
Alignment:
| Q |
18 |
gttattggaaccgatactttcatagtccttttgtcctatcattgtagtaaaacaaatactgtaatattatggcaatggattggagatgcaacttttttga |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7971552 |
gttattggaaccgatactttcatggtccttttgtcctatcattgtagtaaaacaaatactgtaatattatggcaatggattggagatgcaacttttttga |
7971453 |
T |
|
| Q |
118 |
attgatgataaataatgnnnnnnnnnnnnnnnnnngactaaactaaaacctataagaaaatagggaagctctacctgaatagggaaatgtcgtaaatcat |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7971452 |
attgatgataaataatgtttttattttttatttttgactaaactaaaacctataagaaaatagggaagctctacctgaatagggaaatgtcgtaaatcat |
7971353 |
T |
|
| Q |
218 |
gtgacagctgcaaaagggttt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7971352 |
gtgacagctgcaaaagggttt |
7971332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University