View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21000_low_16 (Length: 238)

Name: NF21000_low_16
Description: NF21000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21000_low_16
NF21000_low_16
[»] chr5 (1 HSPs)
chr5 (18-238)||(7971332-7971552)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 7971552 - 7971332
Alignment:
18 gttattggaaccgatactttcatagtccttttgtcctatcattgtagtaaaacaaatactgtaatattatggcaatggattggagatgcaacttttttga 117  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7971552 gttattggaaccgatactttcatggtccttttgtcctatcattgtagtaaaacaaatactgtaatattatggcaatggattggagatgcaacttttttga 7971453  T
118 attgatgataaataatgnnnnnnnnnnnnnnnnnngactaaactaaaacctataagaaaatagggaagctctacctgaatagggaaatgtcgtaaatcat 217  Q
    |||||||||||||||||                  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7971452 attgatgataaataatgtttttattttttatttttgactaaactaaaacctataagaaaatagggaagctctacctgaatagggaaatgtcgtaaatcat 7971353  T
218 gtgacagctgcaaaagggttt 238  Q
    |||||||||||||||||||||    
7971352 gtgacagctgcaaaagggttt 7971332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University