View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21000_low_9 (Length: 331)
Name: NF21000_low_9
Description: NF21000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21000_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 31422972 - 31422743
Alignment:
| Q |
1 |
cctaaatcccatcattgttccttagattctgcttgagatgggtgtctatactagttaacaacattgatgaaaatacaatctagtaaaatggggattgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31422972 |
cctaaatcccatcattgttccttagattctgcttgagatgggtgtctatactagttaacaacattgatgaaaatacaatctagtaaaatggggattgtgt |
31422873 |
T |
 |
| Q |
101 |
aaaagcatagaatagcttatgacatctaagttattgttgaatgtacaattgctttagcagttttggtaggatatttattcttaacactcctcaacttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31422872 |
aaaagcatagaatagcttatgacatctaagatattgttgaatgtacaattgctttagcagttttggtaggata-ttattcttaacactcctcaacttgga |
31422774 |
T |
 |
| Q |
201 |
atagatgttggtcactccccaaccagtttag |
231 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| |
|
|
| T |
31422773 |
atagatattggtcactccccaaccattttag |
31422743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University