View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21003_high_5 (Length: 250)
Name: NF21003_high_5
Description: NF21003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21003_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 244
Target Start/End: Complemental strand, 36640902 - 36640666
Alignment:
| Q |
6 |
agagagatgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttgc |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36640902 |
agagaaatgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtg--gcttgc |
36640805 |
T |
 |
| Q |
106 |
tagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36640804 |
tagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtgg |
36640705 |
T |
 |
| Q |
206 |
ggcgtgtttagctgataggtgggattgtgttgatgatgt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36640704 |
ggcgtgtttagctgataggtgggattgtgttgctgatgt |
36640666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 237
Target Start/End: Complemental strand, 36633536 - 36633305
Alignment:
| Q |
6 |
agagagatgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttgc |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
36633536 |
agagaaatgaactcatttgcagatgctttagcaaaaagtggcgtgaatatggaggggcagagaatttggtggcctatggattaaagtgtgtgaggcttgc |
36633437 |
T |
 |
| Q |
106 |
tagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtgg |
205 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36633436 |
tagtttgcaattcaaaatttattttacagaaatagagaaatctatttgtatatctgtctgtttgctgctgtcctgactgattcggatgctgttgtggtgg |
36633337 |
T |
 |
| Q |
206 |
ggcgtgtttagctgataggtgggattgtgttg |
237 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |
|
|
| T |
36633336 |
ggtgtgtttagctgataggtgggattgtgttg |
36633305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University