View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21003_low_4 (Length: 259)
Name: NF21003_low_4
Description: NF21003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21003_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 27377476 - 27377701
Alignment:
| Q |
18 |
catgcaagcaatcatgaagggtagtctcatcatccctcccacaacagtacaagtaggcaaaattaccaatcccctccctcttgatcctacgaacataaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27377476 |
catgcaagcaatcatgaagggtagtctcatcatccctcccacaacagtacaagtaggcaaaattaccaatc----ccctcttgatcctacgaacataaca |
27377571 |
T |
 |
| Q |
118 |
ttggtgaaaatgtgtggcgcaacnnnnnnncatatataatagtcaagatgcaattggttcctttcgaataacataaattcttccaaccacctttggcagc |
217 |
Q |
| |
|
||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27377572 |
ttggtgaaaatgtgtggcgcaacaaaa----aaacataatagtcaagatgcaattggttcctttcgaataacataaattcttccaaccacctttggcagc |
27377667 |
T |
 |
| Q |
218 |
aggagaggtatcgtgttgcatgttgtaaacactc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27377668 |
aggagaggtatcgtgttgcatgttgtaaacactc |
27377701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University