View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_high_10 (Length: 342)
Name: NF21004_high_10
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 16 - 327
Target Start/End: Complemental strand, 32641689 - 32641381
Alignment:
| Q |
16 |
atagcaataacaatgaagagaaaccaatggcaatggtgttggatgcacaacctcaagagcattatcttcatcatgaggtgaagcctaaggatgaagccgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32641689 |
atagcaataacaatgaagagaaaccaatggcaatggtgttggatgaacaacctcaagagcattatcttcatcatgaggtgaagcctaaggatgaagccgt |
32641590 |
T |
|
| Q |
116 |
tgatgacgacggttcatgtaaaaatgaggcggcggcggcgccatcttcctccggaaacatcacctgcactgaaaccgttgtggatcccaagagggtcaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32641589 |
tgatgacgacggttcatgtaaaaatgaggcggcggcggcgccatcttcctccggaaacatcacctgcactgaaaccgttgtggatcccaagagggtcaaa |
32641490 |
T |
|
| Q |
216 |
aggtaatcttaattactataatcttaacaaatattatttttatctatgatatgatatagtaaatggtttcaccaatcaccaccacccatgcacgttctat |
315 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32641489 |
aggtaatcttaat---tataatcttaacaaatattatttttatctatgatatgatatagtaaatggtttcaccaatcaccaccacccatgcacgttctat |
32641393 |
T |
|
| Q |
316 |
ttatgatatttc |
327 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32641392 |
ttatgatatttc |
32641381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University