View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_high_19 (Length: 243)
Name: NF21004_high_19
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 118 - 226
Target Start/End: Original strand, 35380 - 35488
Alignment:
| Q |
118 |
gccatccatctcaacaatattttcttttttctttcagccagcacgttaactggctgccattttgctgttaccgctctcgttggtatactctccaatgcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35380 |
gccatccatctcaacaatattttcttttttctttcagccagcacgttaactggctgccattttgctgttaccgctctcgttggtatactctccaatgcta |
35479 |
T |
 |
| Q |
218 |
ccggttact |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
35480 |
ccggttact |
35488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 35255 - 35356
Alignment:
| Q |
1 |
cgttggaattatcatcgccaacaaacaactcatgtccaacaatggctatgttttcacttttggtcagccaccttctctcacacattcattcattgttgat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35255 |
cgttggaattatcatcgctaacaaacaactcatgtccaacaatggctatgttttcacttttggtcagccaccttctctcacacattcattcattgttgat |
35354 |
T |
 |
| Q |
101 |
gt |
102 |
Q |
| |
|
|| |
|
|
| T |
35355 |
gt |
35356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 8677502 - 8677443
Alignment:
| Q |
1 |
cgttggaattatcatcgccaacaaacaactcatgtccaacaatggctatgttttcacttt |
60 |
Q |
| |
|
||||||||||||||| || || ||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
8677502 |
cgttggaattatcatggctaataaacagcttatgtccaacaatggctatgctttcacttt |
8677443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University