View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_high_20 (Length: 241)
Name: NF21004_high_20
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 37827884 - 37828087
Alignment:
| Q |
19 |
ttgttttggataagacttttttataaataaattgtgatttatcatcatacagttaaaa-atatcattaattttatgcatattattttgcataggaaaacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37827884 |
ttgttttggataagacttttttataaataaattgtgatttatcatcatacagttaaaaaatatcattaattttatgcatattattatgcataggaaaacc |
37827983 |
T |
 |
| Q |
118 |
taggcttcatagtcgcctacatgcctacatggtttggctcttatcgctttcaagttttgtcctttagatcagaaatgagtaagtcaattttaaggtataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
37827984 |
taggcttcatagtcgcctacatgcctacatggtttggctcttatcgctttcaagttttgtcctttagatcagaaatgagtaaatcaa-tttaaggtataa |
37828082 |
T |
 |
| Q |
218 |
ttgca |
222 |
Q |
| |
|
||||| |
|
|
| T |
37828083 |
ttgca |
37828087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University