View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_high_7 (Length: 384)
Name: NF21004_high_7
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 118 - 167
Target Start/End: Original strand, 5244431 - 5244480
Alignment:
| Q |
118 |
ttcagttttttgtaataaatggctaggaggttttgtctttatgtatgttt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5244431 |
ttcagttttttgtaataaatggctaggaggttttgtctttatgtatgttt |
5244480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 5244353 - 5244393
Alignment:
| Q |
19 |
acttcaatgtctcaaaactagattgtcgtaggaatattggt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5244353 |
acttcaatgtctcaaaactagattgtcgtaggaatattggt |
5244393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 316 - 348
Target Start/End: Original strand, 31824435 - 31824467
Alignment:
| Q |
316 |
gggatgtcatgcagcttattattatgcaacgca |
348 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
31824435 |
gggatatcatgcagcttattattatgcaacgca |
31824467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University