View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_high_9 (Length: 349)
Name: NF21004_high_9
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 35138 - 34862
Alignment:
| Q |
1 |
atcaatttgaaggataaccgctcctcctcctcccccttggctagatggatctaagaaatagtcgacagcacgcatgcattgtttctctgcaaatgcatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35138 |
atcaatttgaaggataaccgctcctcctcctcccccttggctagatggatctaagaaatagtcgacagcacgcatgcattgtttctctgcaaatgcatcc |
35039 |
T |
|
| Q |
101 |
aatccaatcaaatctacctttaattgtttatgtgattgggatcaaaacaaagatttcttcttttctttttagacaagattattaattagaagnnnnnnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35038 |
-----aatcaaatctacctttaattgtttatgtgattgggatcaaaacaaagatttcttcttttctttttagacaagattattaattagaa-aaaaaaaa |
34945 |
T |
|
| Q |
201 |
cctgagtaaaggagatgaacaacatttatgcctcttcatctcaccacacttctcttcgctnnnnnnngcatattcgctattcc |
283 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
34944 |
cccgagtaaaggagatgaacaacatttatgcctcttcatctcaccacacttctcttctctcccccccgcatattcgctattcc |
34862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 332
Target Start/End: Original strand, 34745 - 34796
Alignment:
| Q |
281 |
tccatccattgaacaaacacgggcttattatacaaattttatttacccttgt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34745 |
tccatccattgaacaaacacgggcttattatacaaattttatttacccttgt |
34796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University