View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_low_18 (Length: 270)
Name: NF21004_low_18
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 39017513 - 39017769
Alignment:
| Q |
1 |
gtgtttaggcactttgtgttgatcatcattgccatggttgctgccattgatgaatatgttgagatattggcactgataattctcaagagtaagagtgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39017513 |
gtgtttaggcactttgtgttgatcatcattgccatggttgctgccattgatgaatatgttgagatattggcactgataattctcaagagtaagagtgaat |
39017612 |
T |
|
| Q |
101 |
ttggtctttgctattgaagaatgaagactatagtttagaatatagatgggaaagccacgtaggagaaatgaggaccaataatattttgatttctagattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39017613 |
ttggtctttgctattgaagaatgaagactatagtttagaatatagatgggaaagccacgtaggagaaatgaggaccaataatattttgatttctagattc |
39017712 |
T |
|
| Q |
201 |
ttttcttatctaagtagactcatggggtgagatttccacctcctattctttggtttc |
257 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39017713 |
ttttcttatctaaatagactcatggggtgagatttccacctcctattctttggtttc |
39017769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 34
Target Start/End: Complemental strand, 33830044 - 33830012
Alignment:
| Q |
2 |
tgtttaggcactttgtgttgatcatcattgcca |
34 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33830044 |
tgtttaggcactttgtgttgatcatcattgcca |
33830012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University