View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_low_19 (Length: 269)
Name: NF21004_low_19
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 8 - 154
Target Start/End: Original strand, 31045195 - 31045341
Alignment:
| Q |
8 |
ccaagaatatgaatatataaaataatcttttattagaaaataaaaattacatgtacaaggaaaaagaatggtgaaacatgtactataattaagatcaatt |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31045195 |
ccaaaaatatgaatatataaaataatcttttattagaaaataaaaattacacgtacaaggaaaaagaatggtgaaacatgtactataattaagatcaatt |
31045294 |
T |
 |
| Q |
108 |
taagcttatcttcaacaaaggtaattaactagcttggttggtaagta |
154 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31045295 |
taagcttatcttcaacaatggtaattaactagcttggttggtaagta |
31045341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University