View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_low_23 (Length: 246)
Name: NF21004_low_23
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 8319500 - 8319270
Alignment:
| Q |
1 |
aacaagaagcacaggttttcatgtttagatacctacttaattaataaggatatggtaagactgat---tttagttaagattgaattaataatggaccatg |
97 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8319500 |
aacaagaagcacaagttttcatgtttagatacctacttaattaataaggatatggtaagactgatcattttagttaagattgaattaataatggaccatg |
8319401 |
T |
|
| Q |
98 |
ttgtgctaataattt-gtttgagctgctgcacaacacaacttaactaattatttccagcaagtttaagatcaagttgagtagtgaaatcagtattagcat |
196 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8319400 |
ttgtgctaataatatagtttgagctgctgcacaacacaacttaactaattatttccagcaagtttaagatcaagttgagtagtgaaatcagtattagcat |
8319301 |
T |
|
| Q |
197 |
gactagtccagtaattaatcatggacaaaag |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8319300 |
gactagtccagtaattaatcatggacaaaag |
8319270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University