View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_low_26 (Length: 240)
Name: NF21004_low_26
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 252638 - 252418
Alignment:
| Q |
1 |
ttcatcaaattttgaaaactatttaatacttcaacgaattaaaatgaatctataaagaaaaacgttttaaaa-gttcacggtgaaaactactccgtattt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
252638 |
ttcatcaaattttgaaaactatttaatacttcaacgaattaaaatgaatctataaa-aaaaacgttttaaaaagttcacggtgaaaactactccgtattt |
252540 |
T |
|
| Q |
100 |
gtctaagagttcatggtattaggatatgcaactttttgaaaagttcccatgttgcacctcttccactattttgcttatcttaaagtaaaaattaacatat |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
252539 |
ttctaagagttcatggtattaggatatgtaactttttgaaaagttcccatgttgcacctcttccactattttgcttatcttaaagtaaaaattaacatat |
252440 |
T |
|
| Q |
200 |
acaaaagccctaatatgatcga |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
252439 |
acaaaagccctaatatgatcga |
252418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University