View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21004_low_29 (Length: 224)
Name: NF21004_low_29
Description: NF21004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21004_low_29 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 224
Target Start/End: Original strand, 7541925 - 7542138
Alignment:
| Q |
16 |
attagttatataaaactctcatgtgcatgctt---tattatattgttacataatgctaattcttaatggacacacaaaatcttataccaattgccattgt |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7541925 |
attaggtatataaaactctcatgtgcatgcttaattattatattgttacataatgctaattcttaatggacacacaaaatcttataccaattgccattgt |
7542024 |
T |
 |
| Q |
113 |
caagcttataaacatctcattttacatcaagagaattttaaaatggcaaaatatagtaaaagaaatatgcataaatgcaaactcgggtcata--atacta |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7542025 |
caagcttataaacttctcattttacatcaagagaattttaaaatggcaaaatatagtaaaagaaatatgcataaatgcaaactcgggtcatagtatacta |
7542124 |
T |
 |
| Q |
211 |
ctagctataagcaa |
224 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
7542125 |
cgagctataagcaa |
7542138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University