View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21005_low_4 (Length: 283)
Name: NF21005_low_4
Description: NF21005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21005_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 2 - 140
Target Start/End: Original strand, 6242682 - 6242819
Alignment:
| Q |
2 |
gtgtagaagatgcgtaactgattaaatttagagaggttttgtgagtaatggggttttgattaagataaacttgaagggagaaagatatatagggcttctg |
101 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6242682 |
gtgtagaagatgcgtaactgattaattttagagaggttttgtgagtgatggg-ttttgattaagataaacttgaagggagaaagatatatagggcttctg |
6242780 |
T |
|
| Q |
102 |
acgtgcttcttaagctagctgttttaataggcggagagc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6242781 |
acgtgcttcttaagctagctgttttaataggcggagagc |
6242819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 272
Target Start/End: Original strand, 6242899 - 6242942
Alignment:
| Q |
229 |
tttattattctaattttttaatttgacgcaattttagatgatgt |
272 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6242899 |
tttattattctaattctttaatttgacgcaattttagatgatgt |
6242942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University