View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21007_low_3 (Length: 349)
Name: NF21007_low_3
Description: NF21007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21007_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 55 - 339
Target Start/End: Original strand, 28495324 - 28495611
Alignment:
| Q |
55 |
tttttgcagaagagcagtagctgacattggtgtagcagaaacagtaacagaaccggaagaagcaggttttgatagagaaagatttgcagcagatgttgaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28495324 |
tttttgcagaagagcagtagctgacattggtgtagcagaaacagtaacagaaccggaagaagcaggttttgatagagaaagatttgcagcagatgttgaa |
28495423 |
T |
 |
| Q |
155 |
tttgaagcaggtataccaaatattgatgatgaagaagaacaaatcaaggc---attattattattattagtagtagcatttcccatttgaactatctcag |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28495424 |
tttgaagcaggtataccaaacattgatgatgaagaagaacaaatcaaggcattattattattattattagtagcagcatttcccatttgaactatctcag |
28495523 |
T |
 |
| Q |
252 |
ataaaccagaagaaccataaagggaattagaactttgtcccatttcatgattcccttggtttaaccaaagtgataaacttggcctttg |
339 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28495524 |
ataaaccagaagaaccaaaaagggaattagaactttgtcccatttcatgattcccttggtttaaccaaagtgataaacttggcctttg |
28495611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University