View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21007_low_4 (Length: 301)
Name: NF21007_low_4
Description: NF21007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21007_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 40273668 - 40273720
Alignment:
| Q |
221 |
actcctttcgttttcttacctaatttcatagtttcttctacgtcaaggaacaa |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40273668 |
actcctttcgttttcttacctaatttcatagtttcttctacgtcaaggaacaa |
40273720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University