View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21007_low_5 (Length: 241)
Name: NF21007_low_5
Description: NF21007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21007_low_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 40274022 - 40273789
Alignment:
| Q |
20 |
gaactcaccttgtatcaa--attcataaataattagaatcagtgttgaatttcaatttgtttgctcgaatcacatatttttnnnnnnnnt---------- |
107 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40274022 |
gaactcaccttgtatcaataattcataaataattggaatcagtgttgaatttcaatttgtttgctcgaatcacatattttaaaagttattttaaaaaaaa |
40273923 |
T |
 |
| Q |
108 |
-gtatatattttttctttatattttgacccattcttaaaatttaagcaactgttaccatgtatacccaacaacttcagaagttccgattccaatatatgg |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
40273922 |
agtatatattttttctttataatttgacccattcttaaaatttaagcaactgttaccatgtata-ccaacaacttcagaaattccgattccaacatatgt |
40273824 |
T |
 |
| Q |
207 |
tctacattggtgcatatatcaatataaccgtgtac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40273823 |
tctacattggtgcatatatcaatataaccgtgtac |
40273789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University