View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21008_high_24 (Length: 210)
Name: NF21008_high_24
Description: NF21008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21008_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 36 - 141
Target Start/End: Original strand, 14022347 - 14022452
Alignment:
| Q |
36 |
gttcaaaggaaaattttaatcttcatttgatattcatatacttttgaggttctgtgttatgtgtggtcttaatctaaataaacaaacagcatatacaaat |
135 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14022347 |
gttcaaaggaaaatttcaatcttcatttgatattcatatacttttgaggttctgtgttatgtgtggtcttaatctaaataaacaaacagcatatacaaat |
14022446 |
T |
 |
| Q |
136 |
acaaat |
141 |
Q |
| |
|
|||||| |
|
|
| T |
14022447 |
acaaat |
14022452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University