View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21008_low_20 (Length: 253)
Name: NF21008_low_20
Description: NF21008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21008_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 45 - 243
Target Start/End: Complemental strand, 23009627 - 23009429
Alignment:
| Q |
45 |
gattagtctttccaaaatttgggatacggcacatacctttatctttaaattttaagtaacagatgccgctataaattgcaagattgattataatttccac |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23009627 |
gattagtctttccaaaatttgggatacggcacatacctttatctttaaattttaagcaacagatgccgctataaattgcaagattgattataatttccac |
23009528 |
T |
|
| Q |
145 |
attttctcttggcaaaaaatgaagacaaattattcaagcagaattataattcgtttaactttggcacttctaatggactcgagttctatatatccacag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23009527 |
attttctcttggcaaaaaatgaagacaaatcattcaagctgaattataattcgtttaactttggcacttctaatggactcgagttctatatattcacag |
23009429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University