View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21008_low_21 (Length: 252)
Name: NF21008_low_21
Description: NF21008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21008_low_21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 252
Target Start/End: Original strand, 10441021 - 10441262
Alignment:
| Q |
11 |
cagagaggagaagaaaagatggtcaacaagtacctccaagtgacaaggtttatgaatgcattcttttccgaggaagtgacattaaggtaactatattatc |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441021 |
cagaggggagaagaaaagatggtcaacaagtacctccaagtgacaaggtttatgaatgcattcttttccgaggaagtgacattaaggtaactatattatc |
10441120 |
T |
 |
| Q |
111 |
attatttaactgatttgcagtctattgttaataagagaaataagcatgtgatgaaatatttctgatttattgctcagaagcatctcaccctgtgtggggg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441121 |
attatttaactgatttgcagactattgttaataagagaaataagcatgtgatgaaatatttctgatttattgctcagaagcatctcaccctgtgtggggg |
10441220 |
T |
 |
| Q |
211 |
agttaataaggcttggctgatgttgttgtattgctgtgatat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441221 |
agttaataaggcttggctgatgttgttgtattgctgtgatat |
10441262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University