View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21008_low_22 (Length: 251)
Name: NF21008_low_22
Description: NF21008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21008_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 87 - 237
Target Start/End: Complemental strand, 13539728 - 13539578
Alignment:
| Q |
87 |
acattgattgtggtttatacaattgatatagaaccagtaagaatagaaagcagtacctctacaatttccagtgaatctggatctaatgtagtcgctgctg |
186 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13539728 |
acattgattgtggtttataaaattgatatagaaccagaaagaatagaaagcagtacctctacaatttccagtgaatctggatctaatgtagtcgctgctg |
13539629 |
T |
 |
| Q |
187 |
ataaatccgagtggagtttattggatttgtatgccggttgtggagctatgt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13539628 |
ataaatccgagtggagtttattggatttgtatgccggttgtggagctatgt |
13539578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University