View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21009_low_12 (Length: 325)
Name: NF21009_low_12
Description: NF21009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21009_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 47 - 239
Target Start/End: Complemental strand, 5684182 - 5683983
Alignment:
| Q |
47 |
caaagaaaacctcatccatccgatcaatcctgcggttcagatctaacttttcaattttcccgcgaacactttcaacaagatagtagaaattgaagttgtc |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
5684182 |
caaagaaaacctcagccatccgatcaatcctgcggttcagatctaacttttcaattttcccgcgaacacttt---caagatagtagaaattgaagtt-tc |
5684087 |
T |
 |
| Q |
147 |
aatcttcccttatctccctttgtcgatacc-----------tcaggcgataatttcgccgtatttgagagagtatcgtgatgtatccaaatacgtagatt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684086 |
aatcttcccttatctccctttgtcgatacctcaggcgtgattcaggcgataatttcgccgtatttgagagagtatcgtgatgtatccaaatacgtagatt |
5683987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University