View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21009_low_9 (Length: 365)
Name: NF21009_low_9
Description: NF21009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21009_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 15 - 359
Target Start/End: Original strand, 7095494 - 7095838
Alignment:
| Q |
15 |
ctttgtccccacatttccatacaacacccccttagttgcatgatattcagttagggacacttcttttcatcaaccaattttaagaatatgtgtgtggctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7095494 |
ctttgtccccacatttccatacaacacccccttagctgcatgatattcagttagggacacttcttttcatcaaccaattttaagaatatgtgtgtggctt |
7095593 |
T |
 |
| Q |
115 |
gaaagggaacttgaatccctcatcttttttaaggatgtgattggagaaaataattttatagaggacctggtccttatgatgatttttagttagtttgtct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7095594 |
gaaagggaacttgaatccctcatcttttttaaggatgtgattggagaaaataattttatagaggacctggtccttatgatgatttttagttagtttttct |
7095693 |
T |
 |
| Q |
215 |
ttgataagagatttctagttggctaatgacttcttttttccgaggacatgtattaagtgattgtactttatgatttgggttggtctggtgatgtttgagc |
314 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
7095694 |
ttgacaagagatttctagttggctaatgtcttcttttttccgaggacatgtattaagtgattgtgctttatgacttgggttgatctggtgatgtttgagc |
7095793 |
T |
 |
| Q |
315 |
ctttagagtatgtttcttttaagatctcagattcgattctctctg |
359 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7095794 |
ctttagagtgtgtttcttttaagatctcagattcgattctctctg |
7095838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 325 - 357
Target Start/End: Complemental strand, 27198712 - 27198680
Alignment:
| Q |
325 |
tgtttcttttaagatctcagattcgattctctc |
357 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
27198712 |
tgtttcttttaagatctcatattcgattctctc |
27198680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University