View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2100_low_6 (Length: 367)
Name: NF2100_low_6
Description: NF2100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2100_low_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 13 - 367
Target Start/End: Original strand, 334019 - 334374
Alignment:
| Q |
13 |
gcacagatagcagcaatggagaaatccttggtatgtatttaaagggcttgatttt-atcagttagactcattttcatttatttgcgaatgacctatgtct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
334019 |
gcacagatagcagcaatggagaaatccttggtatgtatttaaagggcttgatttttatcagttagactcattttcatttatttgcgaatgacctatgtct |
334118 |
T |
|
| Q |
112 |
ctctgggaatcatatgtactattggttgaagtgtcaaaatgttggataatacaaaatgctgctttagtttgtaggttttaaaatttataatttatatgat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
334119 |
ctctgggaatcatatgtactattggttgaagtgtcaaaatgttggataatacaaaatgctacttgagtttgtaggttttaaaatttataatttatatgat |
334218 |
T |
|
| Q |
212 |
tatatgatgtatttctcacaattgaattctcaaggttagcttagttacaattgcagctatcaaattataaagtgattagggtgtaatttgtctagactag |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
334219 |
tatatgatgtatttctcacaattgaattctcaaggttagcttagttacaattgcagctatcaatttataaagtgattagggtgtaatttgtctagactag |
334318 |
T |
|
| Q |
312 |
agagcaagctggaaaatatttgagtcaaaacctagggtacataattcactgcgatt |
367 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
334319 |
agagcaaactggaaaatatttgagtcaaaacctagggtacataattcactgcgatt |
334374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University