View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2100_low_7 (Length: 337)
Name: NF2100_low_7
Description: NF2100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2100_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-103; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 37533550 - 37533769
Alignment:
| Q |
1 |
caattagtactacgaactagatgaggtgaagattaatcaacactgaatattgttgaaacttgaaaagcaaaatgaagagataggagacacgaattacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37533550 |
caattagtactacgaactagatgaggtgaagattaatcaacactgaatattgttgaaacttgaaaagcaaaatgaagagataggagacacgaattacaag |
37533649 |
T |
|
| Q |
101 |
gtgtgaaaacgaccatggctataatagaaaaggaagaatgagagagacctcacagttaatgacnnnnnnnctggggactactaattttgggattgtgatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37533650 |
gtgtgaaaacgaccatggctataatagaaaaggaagaatgagagagacctcacagttaatgacaaaaaaactggggactactaattttgggattgtgatt |
37533749 |
T |
|
| Q |
201 |
gtcacactcttcttatatac |
220 |
Q |
| |
|
||| ||||||| |||||||| |
|
|
| T |
37533750 |
gtcccactctttttatatac |
37533769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 231 - 288
Target Start/End: Original strand, 37534078 - 37534135
Alignment:
| Q |
231 |
cattcacattttcttcacgtttaaggggacttcattttgagtgtggtccactactcca |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
37534078 |
cattcacattttcttcacgtttaaggggacttcattttgattgtggaccactactcca |
37534135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 328
Target Start/End: Original strand, 37534174 - 37534207
Alignment:
| Q |
295 |
tagtagtatcacaaatcacaatgatcattttctt |
328 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
37534174 |
tagtagtatcacaaatcacagtgatcattttctt |
37534207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University