View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21010_high_4 (Length: 241)
Name: NF21010_high_4
Description: NF21010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21010_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 59 - 239
Target Start/End: Original strand, 41892165 - 41892345
Alignment:
| Q |
59 |
caactacttgggtatgtatttttactactatcacttcattttttactttgtttttgttcaatggtattgattttgaaatgggtatgttcaggtttcttca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41892165 |
caactacttgggtatgtatttttactactatcacttcattttttactttgtttttgttcaatggtattgattttgaaatgggtatgttcaggtttcttca |
41892264 |
T |
 |
| Q |
159 |
tcttctcagcgattcaggtgtattcatatcaaacctatagctgggactcatacaatgtctgcgccaaaatctgcttcatct |
239 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41892265 |
tcttctcagcgattcaggtgtattcctatcaaacctatagctggggctcatacaatgtctgcgccaaaatctgcttcatct |
41892345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 97 - 196
Target Start/End: Complemental strand, 3730647 - 3730548
Alignment:
| Q |
97 |
ttttttactttgtttttgttcaatggtattgattttgaaatgggtatgttcaggtttcttcatcttctcagcgattcaggtgtattcatatcaaacctat |
196 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||| ||||||| |||| |
|
|
| T |
3730647 |
ttttttactttgtttttgttcaatgatattgattttgaaatgggtatgttcaggtttctttatcttcactgcgattcaggtgtattcctatcaaagctat |
3730548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University