View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21010_high_5 (Length: 234)
Name: NF21010_high_5
Description: NF21010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21010_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 3385726 - 3385524
Alignment:
| Q |
15 |
caaaggggagggagggaattaaaacaattcatcatcattcaacgatctagaaatcaagattaagatatcacggtctatattctcaaacttctcatcaaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3385726 |
caaaggggagggagggaattaaaacaattcatcatcattcaacgatctagaaatcaagattaagatatcacggtctatattctcaaacttctcatcaaca |
3385627 |
T |
|
| Q |
115 |
ttcaaacaatgaatgaatactcggacccattgctaatcggcatactttgttcgaatatagtaaaccatgtccatcactttcaactcaactaggagaagat |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
3385626 |
ttcaaacaatgaatgaatactctgacccattgctaatcggcataccttgttcgaatatagtaaaccatattcatcactttcaactcaactaggagaagat |
3385527 |
T |
|
| Q |
215 |
cct |
217 |
Q |
| |
|
||| |
|
|
| T |
3385526 |
cct |
3385524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University