View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21011_low_4 (Length: 238)
Name: NF21011_low_4
Description: NF21011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21011_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 84 - 210
Target Start/End: Complemental strand, 48393540 - 48393414
Alignment:
| Q |
84 |
atcgacaatgctacttttctatctgataaggaggctgcaattcctgatcatgatctcgaagctgctgcagacatggatgaagatttggattgtatttcca |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393540 |
atcgacaatgctacttttctatctgataaggaggctgcaattcctgatcatgatctcgaagctgctgcagacatggatgaagatttggattgtatttcca |
48393441 |
T |
 |
| Q |
184 |
attcgctgagatacatacatggatatt |
210 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
48393440 |
attcgcagagatacatacatggatatt |
48393414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University