View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21011_low_5 (Length: 229)
Name: NF21011_low_5
Description: NF21011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21011_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 12 - 213
Target Start/End: Complemental strand, 29208085 - 29207881
Alignment:
| Q |
12 |
tgagatgaatgggaggtgtttcttaagcaacaaaacagcttgcatacttcactag----atagtgatacaacctttgttttgaaataagcacaattatat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29208085 |
tgagatgaatgggaggtgtttcttaagcaacaaaacatcttgcatacttcactagctagatagtgatacaacctttgttttgaaataagcacaattatat |
29207986 |
T |
 |
| Q |
108 |
atgtatgaaacaaagttgcattgccaccttgtgcttttaataacacatatatgtgaaatgataatttacatatataaaaataataaatcagcacaagcac |
207 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29207985 |
atgtatgaaacaa-gttgcattgtcaccttgtgcttttaataacacatatatgtgaaatgataatttacatatataaaaataataaatcagcacaagcac |
29207887 |
T |
 |
| Q |
208 |
acaaat |
213 |
Q |
| |
|
|||||| |
|
|
| T |
29207886 |
acaaat |
29207881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 38378289 - 38378369
Alignment:
| Q |
106 |
atatgtatgaaacaaagttgcattgccaccttgtgcttttaataacacatatatgtgaaatgataatttacatatataaaaat |
188 |
Q |
| |
|
||||||||| | | ||||||||||||||| |||||| | |||| |||| ||||| |||||||||| |||||| ||||||||| |
|
|
| T |
38378289 |
atatgtatggagcgaagttgcattgccactttgtgcctctaat--cacacatatgagaaatgataagttacatgtataaaaat |
38378369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University