View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21012_high_2 (Length: 208)
Name: NF21012_high_2
Description: NF21012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21012_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 32036421 - 32036600
Alignment:
| Q |
19 |
tatcttgctaacattgcttgctccaaatactttgtgaactttggcgaatttcttgcactcattagaatggaagtaaggtgcaaataagcaatctggtgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32036421 |
tatcttgctaacattgcttgctccaaatactttgtgaactttggcgaatttcttgcactcattagaatggaagtaaggtgcaaataagcaatctggtgtg |
32036520 |
T |
 |
| Q |
119 |
catcttcttttcaataatttgcaagctgcacaagatgagcttgaacgtggctcataaccctttatgcctttcatctcact |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32036521 |
catcttcttttcaataatttgcaagctgcacaagatgagcttgaacgtggctcataaccctttatgcctttcatttcact |
32036600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 20 - 180
Target Start/End: Original strand, 35808789 - 35808949
Alignment:
| Q |
20 |
atcttgctaacattgcttgctccaaatactttgtgaactttggcgaatttcttgcactcattagaatggaagtaaggtgcaaataagcaatctggtgtgc |
119 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| || | ||||| || ||||||| |||| |||| ||| |
|
|
| T |
35808789 |
atcttgctcacattgcttgctccaaatactttgtgaactttcgcgaatttcttgcactcatcggagcgaaagtatggcgcaaatatacaatttggtatgc |
35808888 |
T |
 |
| Q |
120 |
atcttcttttcaataatttgcaagctgcacaagatgagcttgaacgtggctcataaccctt |
180 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| || ||||| | ||| ||||||||||| |
|
|
| T |
35808889 |
atcttcttttcagaaatttgcaggctgcacaagaggaacttgaccttggttcataaccctt |
35808949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University