View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21014_high_30 (Length: 317)
Name: NF21014_high_30
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21014_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 303
Target Start/End: Original strand, 1215275 - 1215561
Alignment:
| Q |
19 |
gaattttcatatgcttagtttacagaaataagtagtatcatagtatgcaaaaatttgtaggatggtaagcgcatgatgaagacattgaaagaccttgnnn |
118 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1215275 |
gaattttcatatgcttagtttacagaagtaagtagtatcatagtatgcaaaaatttgtaggatggtaagcgcatgatgaagacattgaaagaccttgatt |
1215374 |
T |
|
| Q |
119 |
nnnnnncgaaaattaaagccttgaaatgattctttattttcccacgcgaacacttgtcttaggtttatattttttgtaaccatat--gtgtttaatttta |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1215375 |
ttttttcaaaaattaaagccttgaaatgattctttatttccccacgcgaacacttgtcttaggtttatattttttgtaaccatatatgtgtttaatttta |
1215474 |
T |
|
| Q |
217 |
tagatgtttgtttggctatttatatctgttaatgtatgcgcatatacgtgtatgcatgtatgatcggtatatgtaggtgcacctttg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1215475 |
tagatgtttgtttggctatttatatctgttaatgtatgcgcatatatgtgtatgcatgtatgatcggtatatgtaggtgcacctttg |
1215561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University