View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21014_high_42 (Length: 258)
Name: NF21014_high_42
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21014_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 6164729 - 6164502
Alignment:
| Q |
14 |
caaatattactcttgctttctatcatatttacacctataggagttcttgatcatgcttcaacaagaggttaaaggagattttagttcttatgttggcatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6164729 |
caaatattactcttgctttctatcatatttacacctatagaagttcttgatcatgcttcaacaagaggttaaaggagattttagttcttatgttggcatc |
6164630 |
T |
 |
| Q |
114 |
aaagctgttgtttatgctgaattactagctgctatgaaaggcattgaaataggttaggagaaaaattagaatttcatttgtcttgaatgtgacttattat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6164629 |
aaagctgttgtttatgctgaattactagctgctatgaaaggcattgaaataggttaggagagaaattagaatttcatttgtcttgaatgtgacttattat |
6164530 |
T |
 |
| Q |
214 |
ggacgcttttaagaatcatcatattgct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6164529 |
ggacgcttttaagaatcatcatattgct |
6164502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University