View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21014_high_46 (Length: 250)
Name: NF21014_high_46
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21014_high_46 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 50 - 250
Target Start/End: Complemental strand, 6644043 - 6643843
Alignment:
| Q |
50 |
actttctaggagttttctagagctatggatatggaaatggattccctacttcaaatgtgtgacccgattacaaaccttggcagtcatattaaattagtgg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6644043 |
actttctaggagttttctagagctatggatatggaaatggattccctacttcaaatgtgtgacccgattacaaaccttggcagtcatattaaattagtgg |
6643944 |
T |
 |
| Q |
150 |
ctaagatcctttaaaaataatttattaatggtatactttaacttgactcgttagattctgaaatcagcattggttaaggttcattattccatgaaacttc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6643943 |
ctaagatcctttaaaaataatttattaatggtatactttaacttgactcgttagattctgaaatcagcattggttaaggttcattattccgtgaaacttc |
6643844 |
T |
 |
| Q |
250 |
t |
250 |
Q |
| |
|
| |
|
|
| T |
6643843 |
t |
6643843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 11 - 54
Target Start/End: Complemental strand, 6644108 - 6644065
Alignment:
| Q |
11 |
cagagaggtaagaatatatattgtggttgaactccaagaacttt |
54 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6644108 |
cagaaaggtaagaatatatattgtggttgaactccaagaacttt |
6644065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University