View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21014_high_53 (Length: 227)
Name: NF21014_high_53
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21014_high_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 135 - 221
Target Start/End: Original strand, 11735302 - 11735389
Alignment:
| Q |
135 |
tatgctcaaaactcctgaatgtatagtttgtaattcacattaatcttcaaattaagcacctctgggattaatttga-gatcgaaaaat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
11735302 |
tatgctcaaaactcctgaatgtatagtttgtaattcacattaatcttcaaattaagcacctctgagattaatttgacgatcgaaaaat |
11735389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 11735168 - 11735205
Alignment:
| Q |
1 |
ctagaaaaagattatggattagtatggaaaaaccgtct |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11735168 |
ctagaaaaagattatggattagtatggaaaaaccgtct |
11735205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University