View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21014_high_61 (Length: 208)
Name: NF21014_high_61
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21014_high_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 31781098 - 31781270
Alignment:
| Q |
16 |
attatactactacttactc--actcagtattactctcacttcacaacataaaaccacttttctaatttataaacctcaccttcttccatcattaatatca |
113 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31781098 |
attatactactacttactctcactcagtagtactc--acttcacaacataaaaccacttttctaatttataaacctcaccttcttccatcattaatatca |
31781195 |
T |
|
| Q |
114 |
aaattattttctgttattccatcgttttatgaatacaaacttcaaaccatgccgacaccggtatcatcagcaaga |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
31781196 |
aaattattttctgttattccatcgttttatgaatacaaacttcaaaccatgccaacaccagtatcatcagcaaga |
31781270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University