View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21014_low_25 (Length: 352)

Name: NF21014_low_25
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21014_low_25
NF21014_low_25
[»] chr2 (1 HSPs)
chr2 (18-352)||(38831287-38831621)
[»] chr4 (1 HSPs)
chr4 (95-146)||(30463872-30463923)


Alignment Details
Target: chr2 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 18 - 352
Target Start/End: Complemental strand, 38831621 - 38831287
Alignment:
18 gctagcagtggcaccattgagtagcataagagatgaaagccaaagagaaatggaggagaatttatcaattgagacatgtgactttgctgatctttccgaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38831621 gctagcagtggcaccattgagtagcataagagatgaaagccaaagagaaatggaggagaatttatcaattgagacatgtgactttgctgatctttccgaa 38831522  T
118 ggaaacttattggaaagcatcaatttcgaattcgatgatgatttcttcgtatgtttcaacgacggagatgtgttaccggatcttgagatggacccggaaa 217  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
38831521 gggaacttattggaaagcatcaatttcgaattcgatgatgatttcttcgtatgcttcaacgacggagatgtgttaccggatcttgagatggacccggaaa 38831422  T
218 tgcttgctgaattctccctcagcagcagcggtgaggaatcggatataaattcgtcgggtgcaaatagcaaatcttgtaatgatgggaacatggttagtat 317  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
38831421 tgcttgctgaattctccctcagcagcagcggtgaggaatcggatataaattcgtcgggtgcaaatagcaaatcttgtaatgatgggaatatggttagtat 38831322  T
318 tgagagaaaattacaagatgaagagaaagtagttt 352  Q
    |||||||||||||||||||||||||||||||||||    
38831321 tgagagaaaattacaagatgaagagaaagtagttt 38831287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 95 - 146
Target Start/End: Original strand, 30463872 - 30463923
Alignment:
95 gtgactttgctgatctttccgaaggaaacttattggaaagcatcaatttcga 146  Q
    |||||||||  || |||||||||||||| ||||||||||||||||| |||||    
30463872 gtgactttggcgacctttccgaaggaaatttattggaaagcatcaacttcga 30463923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University