View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21014_low_37 (Length: 295)
Name: NF21014_low_37
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21014_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 178 - 282
Target Start/End: Original strand, 44172547 - 44172651
Alignment:
| Q |
178 |
cacaaacccaaatcagaataacccagaaacccacccagaataaagttgataaaaaatgtgtctttgctttgatagatttgggtacgaaaaaatgacctga |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44172547 |
cacaaacccaaatcagaataacccagaaacccacccagaataaagttgataaaaaatgtgtctttgctttgatagatttgggtacgaaaaaatgacctga |
44172646 |
T |
 |
| Q |
278 |
gatct |
282 |
Q |
| |
|
||||| |
|
|
| T |
44172647 |
gatct |
44172651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 44172374 - 44172505
Alignment:
| Q |
1 |
tacatggtcgtctcttcatttcagcaacataaaaatgggaaacaaaaagaannnnnnnnnnnngttccttaaaatgttgtccaagtttcctattttaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44172374 |
tacatggtcgtctcttcatttcagcaacataaaaatgggaaacaaaaagaatattttttttt-gttccttaaaatgttgtccaagtttcctattttaaaa |
44172472 |
T |
 |
| Q |
101 |
tatgtatcaaagattaaagtttcaaactttaac |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44172473 |
tatgtatcaaagattaaagtttcaaactttaac |
44172505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University