View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21014_low_47 (Length: 250)
Name: NF21014_low_47
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21014_low_47 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 23280085 - 23279845
Alignment:
| Q |
10 |
aagaaaaggtgtgttgtttgaatccaaaaagtcatgattagagggaggaggagaattcatagttgataaccaaaacatatttttatcaaatgtgacattc |
109 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23280085 |
aagaaatggtgtgttgcttgaatccaaaaagtcatgattagagggaggaggagaattcatagttgataaccaaaacatattttcatcaaatgtgacattc |
23279986 |
T |
|
| Q |
110 |
ctagaaataattgttttatgactcaacaactcatgacatttataacttttacgatttgaaggataacccaaaaatacacatggggttgagcgagactata |
209 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
23279985 |
ctagaaataattgtattatgactcgacaactcatgacatttataacttttacgattggaaggataacccaaaaatacatatgtggttgagcgagactata |
23279886 |
T |
|
| Q |
210 |
atttatttctagatagaggaatatgagggtaacagagacaa |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
23279885 |
atttatttttagatagaggaatatgagggtaacatagacaa |
23279845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University