View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21014_low_54 (Length: 227)
Name: NF21014_low_54
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21014_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 38265854 - 38265635
Alignment:
| Q |
1 |
attaatcctctccaagaaattaagagtttgatatgtaaaacgatcaacgacagaaacacccaaatccgaatcaaaatgatgtgaatacgaactctctcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
38265854 |
attaatcctctccaagaaattaagagtttgatatgtaaagcgatcaacgacagaaacacccaaatccaaatcagaatgatgtgaatacgaactctctcct |
38265755 |
T |
 |
| Q |
101 |
ttcaaactacttccaatagctaaaacaccaggtgaacgaaggtctgagaaaagagtagcagcttgacaagtatccaccattatcaacaactccttaaacc |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38265754 |
ttcacactacttccaatagctaaaacaccaggtgaacgaaggtctgagaaaagagtagcagcttgacaagtatccaccattatcaacaactccttaaacc |
38265655 |
T |
 |
| Q |
201 |
tgtgattctctttcatctca |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38265654 |
tgtgattctctttcatctca |
38265635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University