View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21014_low_55 (Length: 227)

Name: NF21014_low_55
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21014_low_55
NF21014_low_55
[»] chr6 (2 HSPs)
chr6 (135-221)||(11735302-11735389)
chr6 (1-38)||(11735168-11735205)


Alignment Details
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 135 - 221
Target Start/End: Original strand, 11735302 - 11735389
Alignment:
135 tatgctcaaaactcctgaatgtatagtttgtaattcacattaatcttcaaattaagcacctctgggattaatttga-gatcgaaaaat 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||    
11735302 tatgctcaaaactcctgaatgtatagtttgtaattcacattaatcttcaaattaagcacctctgagattaatttgacgatcgaaaaat 11735389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 11735168 - 11735205
Alignment:
1 ctagaaaaagattatggattagtatggaaaaaccgtct 38  Q
    ||||||||||||||||||||||||||||||||||||||    
11735168 ctagaaaaagattatggattagtatggaaaaaccgtct 11735205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University