View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21014_low_64 (Length: 208)
Name: NF21014_low_64
Description: NF21014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21014_low_64 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 6906725 - 6906551
Alignment:
| Q |
15 |
cagagacaggtattcaactgtgctttccagaatacatttttaatcacttagattttgtattcatctttcttacctcttcacgagcataaggacactctta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6906725 |
cagagacaggtattcaactgtgctttcctgaatacatttttaatcgcttagattttgtattcatctttcttacctcttcacgagcataaggacactctta |
6906626 |
T |
|
| Q |
115 |
attatattactcttgcaaactttcacacaaaaatgttgcaatgatacgaattgtcggttcgaagctcaagcattc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
6906625 |
attatattactcttgcaaactttcacacaaaaatgttgcaatgatacgaattgtcggctcgaagcttaagcattc |
6906551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University