View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21015_high_6 (Length: 342)
Name: NF21015_high_6
Description: NF21015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21015_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 34330231 - 34330426
Alignment:
| Q |
13 |
ataacaaaccttgttgactgttccagctagcttctgatgaagctgttggtgttgcagcatggaaagaacgagctcgatagtttctgatgtttgcataacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330231 |
ataacaaaccttgttgactgttccagctagcttctgatgaagctgttggtgttgcagcatggaaagaacgagctcgatagtttctgatgtttgcataacc |
34330330 |
T |
|
| Q |
113 |
atccattgatgaagcagatgagtatcttgttgtatctggtataacaatgctttctgtttcattgttaacattgatcactactggtgaaactctgct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330331 |
atccattgatgaagcagatgagtatcttgttgtatctggtataacaatgctttctgtttcattgttaacattgatcactactggtgaaactctgct |
34330426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 276 - 335
Target Start/End: Original strand, 34330494 - 34330553
Alignment:
| Q |
276 |
ccttcgttgaagtatttgtgtgcgtcgaatatgctgagttctgaggtgggatcgtcgagt |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330494 |
ccttcgttgaagtatttgtgtgcgtcgaatatgctgagttctgaggtgggatcgtcgagt |
34330553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University