View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21015_high_8 (Length: 204)
Name: NF21015_high_8
Description: NF21015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21015_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 11 - 182
Target Start/End: Complemental strand, 40588287 - 40588116
Alignment:
| Q |
11 |
ggagaagcaaagggagtgatggaaaggtttgagataggtaatgttcctatggagttaaggtatgtacaatttgtgagtcttcctctaatatgttttagga |
110 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40588287 |
ggagtagctaagggagtgatggaaaggtttgagataggtgatgttcctatggagttaaggtatgtacaatttgtgagtcttcctctaatatgttttagga |
40588188 |
T |
|
| Q |
111 |
atattagtaaagaggaagttgaaaagaaatttgtggaagttagaagccttgtgaaaagctatatgggaagag |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40588187 |
atattagtaaagaggaagttgaaaagaaatttgtggaagttagaagccttgtgaaaagctatatgggaagag |
40588116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University